Introduction
Avian Influenza viruses (AIVs) and Avulaviruses belonging to the paramixoviridae are enveloped negative-strand RNA viruses that cause disease in wild and domestic birds [1–3]. The primary hosts of these viruses are wild waterfowl. Both AIV and avulaviruses are divided into low-virulent wild bird viruses and virulent poultry viruses [4].
In birds, AIVs are shed in the feces and respiratory secretions. They can all be spread through direct contact with secretions from infected birds, especially through feces or through contaminated feed and water. Highly pathogenic avian influenza is a disease listed in the World Organization for Animal Health (WOAH) [5]. Moreover, these viruses present a threat to both animal and human health, due to the ability of viruses to change the hosts. Some AIVs have a zoonotic potential with transmissions between poultry and mammals, including swine and humans [3].
Newcastle disease viruses (NDVs), caused by avian orthoaviulavirus 1 (AOAV-1), are of great economic importance due to their global distribution and devastating infections in poultry [6,7]. Newcastle disease is a highly contagious and often severe disease found worldwide that affects birds including domestic poultry. Newcastle disease, in its highly pathogenic form, is a WOAH-listed disease and must be reported. ND can present a clinical picture very similar to avian influenza, so laboratory testing is important to confirm the diagnosis [8].
Up to now NDV genotype VII widely circulate in Africa and Asia. In recent years, there has been a sharp increase in cases of Newcastle disease in Russia. The viruses are likely introduced to poultry yards by wild birds, which in the countryside feed freely along with chickens [9].
Since wild birds spread both AIV and NDV, monitoring in the wild is necessary to control these viruses.
Emerging of virus infections is a growing concern among poultry industries. Rapid diagnosis is essential for the control and prevention of infections. Simple diagnostic systems are required to screen large numbers of samples during routine surveillance.
For the effective control of the circulation of NDVs and AIVs serological diagnostic methods are widely used. Hemagglutination inhibition (HI) test and ELISA are the most commonly used method for determining antibodies. These methods were undertaken in the serologic survey of AIV, NDV, infectious bronchitis virus (IBV), egg drop syndrome, and reovirus in chickens in Bangladesh [10].
To determine the optimal screening method as a first step in serosurveillance, the HI assay was compared with an ELISA. The sensitivity and specificity of the ELISA were 97% and 99.8%, while of HI-test was 43% and 99.8%, respectively; therefore, ELISA provides superior sensitivity for the screening of chicken flocks [11].
He F. with co-authors developed a dual-function ELISA for the detection of antigen and antibody against H7 AIV using two monoclonal antibodies (Mabs) recognizing two conformational epitopes on H7 HA [14].
A colloid gold strip (CGS) test for detecting antibodies to H5 AIV was developed. The CGS test is rapid and does not require specialized equipment. It could be useful for detecting H5N1 antibodies in the field [15].
The tetraplex fluorescence inhibitory microsphere enzyme-linked immunosorbent assay was developed to detect and discriminate antibodies specific to influenza AIV and NDV viruses in the serum of chicken birds. The method was assembled for analysis on a Luminex® (Bioplex®)-type platform using mouse MAbs specific for each of the targets [16].
A multiplex PCR-based Luminex suspension microarray assay was developed to identify different avian respiratory viruses in a single reaction, allowing differentiation of the AIV, NDV, IBV, and infectious laryngotracheitis virus [17].
An assay based on CRISPR-Cas12a using primers targeting the M and NP was used to detect AIV of all subtypes. This assay showed no cross-reactivity with other avian-derived RNA viruses such as NDV, IBDV, and IBV [18].
Immunochromatographic test strips (ICT) have been designed for the detection of AIVs and NDVs. The detection principle was based on the “sandwich” immunoreaction, where gold-labeled antibodies served as signal vehicles. The test provided a signal that can be detected by the naked eye [19,20]
An antigen capture immunoassay and a colloidal gold ICT strip using MAbs have been developed for the detection of the H9N2 influenza virus [21,22].
A large number of tests have been developed for the specific detection of H7 influenza viruses. MAbs against hemagglutinin or neuraminidase have been used in sandwich ELISAs targeting conserved viral antigens [23–26].
ICT strips have been developed for the rapid detection of H7 viruses using MAbs against H7N9 [27,28]. Based on such strips, detection of the H7 influenza virus was achieved within 10 minutes [29]. A strip based on monoclonal antibodies was developed to detect the H6 influenza virus [30].
The methods described above are highly sensitive and specific, but their use is difficult in the complete absence of information about the possible pathogen. An algorithm that will primarily differentiate between AIV, NDV, and APMV-4 will allow for the saving of primers and strips in further virus diagnostics. Here, we describe protocols of the detection and differentiation of AIVs and paramyxoviruses. The detection of influenza viruses was based on the binding of viruses to the receptor analog. Detection of paramixoviruses was based on classical ELISA with antibody-coated plate and peroxidase-labeled antibody.
Material and Methods
Reagents and solutions
Horseradish peroxidase was from Sigma-Aldrich #P8375, USA. Antibodies against mouse and chicken immunoglobulins conjugated with horseradish peroxidase were from Sigma, USA. Fetuin from fetal bovine serum (Sigma-Aldrich, #F3004) USA. MycoKill AB solution was from PAA Laboratories GmbH, Pasching, Austria.
The following solutions were used:
Phosphate buffered saline, 0.02 M, pH 7.2 (PBS).
PBS was supplemented with 0.1 mg/ml kanamycin, 0.4 mg/ml gentamicin, 0.01 mg/ml nystatin, and 2% MycoKill AB solution.
Washing solution (WS): 0.01% tween-80 in PBS.
Blocking solution (BS): 0.1% solution of BSA in PBS.
Reaction solution (RS): 0.02% tween-80 and 0.1% BSA in PBS.
Stock solution of 3,3’,5,5’-tetramethylbenzidine (TMB). 1g TMB in 100 ml dimethyl sulfoxide; store in aliquots at –20oC.
Substrate solution (SS). 0.1 ml of 1% stock solution of TMB and 10 µl of 30% hydrogen peroxide in 10 ml of 0.05 M sodium acetate buffer pH 5.5.
Stop solution: 3% H2S04 in water.
Solutions for synthesis of peroxidase-labeled preparations.
Freshly prepared 0.2 M NaIO4 solution in water
1 M and 0.1 M sodium carbonate buffers, pH 9.3.
Freshly prepared 5 mg/ml solution of NaBH4 in water
1 M Tris buffer, pH 6.0.
0.1 M Tris buffer, pH 7.2.
Animals
BALB/c mice were from the Lesnoye farm, Moscow, Russia. Embryonated chicken eggs (CEs) were from the Poultry Farm “Ptichnoye”, Moscow, Russia. The chickens were from a poultry farm “Tomilinskaya”, Moscow region, Russia. The work with live viruses was carried out in a biosafety level 3 facility. All tests were carried out in compliance with the standard for keeping and care of laboratory animals GOST 33215-2014, adopted by the Interstate Council for Standardization, Metrology, and Certification, in accordance with the requirements of Directive 2010/63/EU of the European Parliament and of the Council of the European Union of 22.09.2010 on the protection of animals used for scientific purposes.
Viruses
Avian feces were collected on the banks of ponds in Moscow. Feces were suspended in PBS supplemented with 0.1 mg/ml kanamycin, 0.4 mg/ml gentamicin, 0.01 mg/ml nystatin, and 2% MycoKill AB solution. The suspension was centrifuged for 10 minutes at 4,000 rpm, and 0.2 ml of the supernatants were inoculated into the allantoic chamber of 10-day-old CE. Allantoic fluids were collected after 48 hours and tested by hemagglutination assay. The virus amount was expressed in hemaglutinating units. 50% infective dose (EID50) for each virus stock was determined by titration in CE.
Sequencing
Isolation of viral RNA was performed with a commercial QIAamp Viral RNA mini kit (Qiagen, # 52904). Genome segments were obtained by revers transcription and PCR with specific terminal primers, MMLV, and Taq-polymerase (Alpha-Ferment Ltd., Moscow, Russia). The fragments were separated by electrophoresis in 1%–1.3% agarose gel and extracted from the gel with the Diatom DNA Elution kit (Isogene Laboratory Ltd., Moscow, Russia, # D1031). Sequencing was performed with terminal or internal primers with the BrightDye ™ Terminator Cycle Sequencing Kit v3.1 (Nimagen, the Netherlands), followed by analysis on an ABI PRISM 3100-Avant automated DNA sequencer (Applied Biosystems 3100-Avant Genetic Analyzer, Foster City, USA).
To amplify the F genes of NDV and APMV-4, the following pairs of primers were used: fFapmv2(ATGGGCTCCAGACCTTCTAC)—rFapmv2(CTGCCACTGCTAGTTGCGATAATCC) and fFapmv4(v2) (CAAYCAYAATGAGGYTATCAMRCACAATC) - rFapmv4(CTAGAAAGGCGTCCCYAATTTAGTGG) - respectively.
Preparation of mouse antibodies
Mice were infected intranasally with 50 μl of infections AF, containing 107 EID50 of AIVs or paramyxoviruses. Two weeks later the infection was repeated. After another 2 weeks, total bloods from the mice were taken and serums were obtained.
Immunization of chickens with NDV
Laying hens were infected with the NDV/Duck/Moscow/3639/2008 virus by adding 109 EID50 virus per hen to the drinker. Two weeks later, chickens were infected with the highly pathogenic virus NDV/Chicken/Moscow/6081/2022. Two weeks later, eggs were collected from hens immunized in this way
Immunization of chickens with APMV-4
The paramyxovirus APMV4/duck/Moscow/4096/2010 was added to the drinking bowl of laying hens. Two weeks later hens were injected subcutaneously with 0.5 ml of a suspension (1 μg of protein) of the purified virus APMV4/duck/Moscow/4572/2011. After 2 weeks, eggs were collected from immune hens.
Preparation of egg yolk immunoglobulins (IgY)
The yolks of 4 eggs were separated from the whites, and the chalazas were carefully separated, washed twice in cold distilled water, and transferred to a plastic container with 40 ml of PBS pH 7.4. Stirred thoroughly, adjusted the volume to 250 ml with water, adjusted the pH to 4.2 using HCL, and frozen at –30oC. The next day suspension was slowly thawed and centrifuged for 30 minutes at 10,000 g. Added 1 gm of fine activated carbon powder to the supernatant stirred for 30 minutes and filtrated through a paper filter. Added ammonium sulfate up to 25% to the supernatant and kept it for 2 hours at +4oC. Centrifuged for 30 minutes at 10,000 gm, dissolved the sediments in 10 ml of PBS, aliquot, and stored at –20oC.
Assay of mouse and chicken antibody preparations
Virus-containing allantoic fluids (VAFs) were clarified from the cellular debris by low-speed centrifugation. The viruses were pelleted by high-speed centrifugation through 20% sucrose, resuspended in 60% glycerol-PBS solution containing 0.02% sodium azide to the final virus concentration of 1 mg/ml, and stored at –20oC. Virus concentrate was diluted in PBS to a final concentration of 10 µg/ml of total protein and incubated in the wells of the 96-well plate for 4 hours at 4oC. The virus-non-coated plate was used as a control. After the coating step, 0.25 ml of BS were added per well and incubated for 1 hour at 20oC to prevent the non-specific binding to plastic. The BSA solution was discarded, and 0.1 ml of serial three-fold dilutions of the antibody in RS were incubated for 2 hours at 4oC. The plates were rinsed with WS and incubated for 2 hours at 4oC with antibodies against mouse or chicken immunoglobulins conjugated with horseradish peroxidase in RS. After six washings with WS, the amount of bound conjugate was quantified using 3,3’,5,5’-tetramethylbenzidine as a substrate. Reaction was stopped by adding 0.05 ml of stop solution and absorbance was measured at 450 nm.
Synthesis of peroxidase-labeled preparations
Synthesis of HRP-labeled fetuine (Fet-HRP) is described in [31]. Conjugation of HRP with immunoglobulins was carried out similarly. Briefly: freshly prepared 0.2 M NaIO4 solution in water added to HRP in bidistilled water and incubated for 20 minutes in the dark at room temperature. The reaction mixture was desalted, and the solutions of fetuin or immunoglobulins in sodium carbonate buffer pH 9.3 were added and incubated for 4 hours in the dark. Freshly prepared 5 mg/ml solution of NaBH4 in water added and incubated for 30 minutes on ice. Carefully adjust the pH to neutral with 1 M Tris pH 6 on ice. Major HRP-containing fractions were collected by chromatography on Sephacryl S-200, mixed, aliquoted, and stored at –20oC.
Detection of influenza viruses by fetuin-binding (FB) test
96-well plates were coated with a solution of fetuin 5 μg/ml and washed with water. Serial two-fold dilutions of VAFs was added into the wells and incubated for 2 hours at 4°C. After washing fet-HRP conjugate solution in RS was added and plates were incubated for 1 hour at 4°C. A color reaction was carried out as described above.
Detection of NDVs with the use of immune mouse serum
96-well plate was coated with a solution of purified anti-NDV IgY 5 μg/ml and washed. Serial dilutions of VAFs were added into the wells and incubated for 2 hours at 4°C. The plate was washed and anti-NDV mouse serum diluted 500 times with RS was added and incubated for 2 hours at 4°C. Antibodies against mouse immunoglobulins conjugated with HRP diluted on RS were added and incubated for 1 hour at 4°C. After that, a color reaction was carried out.
Detection of NDVs with the anti-NDV IgY conjugate with HRP
96-well plate was coated with a solution of purified anti-NDV IgY 5 μg/ml and washed. VAFs was added into the wells and incubated for 2 hours at 4°C. The plate was washed, and a conjugate of anti-NDV IgY with HRP on RS was added and incubated for 1 hour at 4°C. After that, a color reaction was carried out.
Results
Moscow ponds during the autumn migration of birds are the site of large concentrations of mallard ducks, which are one of the carriers of the avian influenza virus. In 2006–2023, we monitored birds for influenza and paramyxoviruses (32). Avian feces were collected and inoculated into CE. Positive hemagglutination test samples were analyzed further. Final identification of viruses was performed based on complete or partly genome sequencing. To reduce the cost and simplify the issue, we preliminarily differentiated influenza viruses from paramyxoviruses NDV and APMV-4 using assays technically similar to standard ELISA. Here we describe virus identification protocols.
Differentiation of AIVs from paramyxoviruses
Detection of AIVs
The detection of influenza viruses was based on the binding of viruses to a receptor analog. We previously showed that AIVs bind well to the sialylglycoprotein fetuin [31]. At the first stage of the assay, 96-well ELISA plates were coated with fetuin. Then the VAFs were adsorbed in the wells of fetuin-coated plates. After sorption, the plate was incubated with a solution of Fet-HRP and visualized by color reaction. All AIV-containing VAFs were positive in that test, while paramyxovirus-containing VAFs were negative (Fig. 1).
Figure 1.
A representative readout of a plate where samples of VAFs, that were positive in hemagglutination assay, were tested for fetuin binding. The viruses are designated by strain number and isolation year, for example, 5172/15 stands for А/duck/Moscow/5172/2015.
Table 1.
Binding of viruses to fetuin and antibodies and the result of typing based on the sequence of the genome fragment.
| # | Strain | A | B | C | D | Type |
| 1 | A/gull/Moscow/3100/2006 | + | + | − | − | H6N2 |
| 2 | A/duck/Moscow/3554/2008 | + | + | − | − | H3N1 |
| 3 | A/duck/Moscow/3556/2008 | + | + | − | - | H3N1 |
| 4 | A/duck/Moscow/3641/2008 | + | + | − | − | H11N9 |
| 5 | A/duck/Moscow/3661/2008 | + | + | − | − | H4N6 |
| 6 | A/duck/Moscow/3720/2009 | + | + | − | − | H6N2 |
| 7 | A/duck/Moscow/3735/2009 | + | + | − | − | H4N6 |
| 8 | A/duck/Moscow/3740/2009 | + | + | − | − | H4N6 |
| 9 | A/duck/Moscow/3799/2009 | + | + | − | − | H4N6 |
| 10 | A/duck/Moscow/3806/2009 | + | + | − | − | H3N8 |
| 11 | A/duck/Moscow/4031/2010 | + | + | − | − | H6N2 |
| 12 | A/duck/Moscow/4182/2010 | + | + | − | − | H5N3 |
| 13 | A/duck/Moscow/4203/2010 | + | + | − | − | H3N8 |
| 14 | A/duck/Moscow/4206/2010 | + | + | − | − | H5N3 |
| 15 | A/duck/Moscow/4238/2010 | + | + | − | − | H3N6 |
| 16 | A/duck/Moscow/4242/2010 | + | + | − | − | H3N8 |
| 17 | A/duck/Moscow/4298/2010 | + | + | − | − | H3N8 |
| 18 | A/duck/Moscow/4494/2011 | + | + | − | − | H3N8 |
| 19 | A/duck/Moscow/4518/2011 | + | + | − | − | H4N6 |
| 20 | A/duck/Moscow/4521/2011 | + | + | − | − | H3N8 |
| 21 | A/duck/Moscow/4522/2011 | + | + | − | − | H3N8 |
| 22 | A/duck/Moscow/4524/2011 mix | + | + | − | − | H3N2/8 |
| 23 | A/duck/Moscow/4525/2011 | + | + | − | − | AIV |
| 24 | A/duck/Moscow/4528/2011 | + | + | − | − | H4N6 |
| 25 | A/duck/Moscow/4533/2011 | + | + | − | − | AIV |
| 26 | A/duck/Moscow/4569/2011 | + | + | − | − | AIV |
| 27 | A/duck/Moscow/4570/2011 | + | + | − | − | AIV |
| 28 | A/duck/Moscow/4641/2011 | + | + | − | − | H4N6 |
| 29 | A/duck/Moscow/4643/2011 | + | + | − | − | H4N6 |
| 30 | A/duck/Moscow/4661/2011 | + | + | − | − | H3N8 |
| 31 | A/duck/Moscow/4680/2011 | + | + | − | − | AIV |
| 32 | A/duck/Moscow/4681/2011 | + | + | − | − | H3N8 |
| 33 | A/duck/Moscow/4771/2012 | + | + | − | − | H4N6 |
| 34 | A/duck/Moscow/4772/2012 | + | + | − | − | H4N6 |
| 35 | A/duck/Moscow/4780/2012 | + | + | − | − | H3N8 |
| 36 | A/Duck/Moscow/4781/2012 | + | + | − | − | H4N6 |
| 37 | A/duck/Moscow/4788/2012 | + | + | − | − | H3N8 |
| 38 | A/Duck/Moscow/4843/2012 | + | + | − | − | H4N6 |
| 39 | A/duck/Moscow/4844/2012 | + | + | − | − | H4N6 |
| 40 | A/duck/Moscow/4952/2013 | + | + | − | − | H5N3 |
| 41 | A/duck/Moscow/4970/2013 | + | + | − | − | H1N1 |
| 42 | A/duck/Moscow/4971/2013 | + | + | − | − | H5N3 |
| 43 | A/duck/Moscow/5037/2014 | + | + | − | − | H3N8 |
| 44 | A/duck/Moscow/5163/2015 | + | + | − | − | H3N6 |
| 45 | A/duck/Moscow/5169/2015 | + | + | − | − | H3N6 |
| 46 | A/duck/Moscow/5171/2015 | + | + | − | − | H3N6 |
| 47 | A/duck/Moscow/5172/2015 | + | + | − | − | H3N6 |
| 48 | A/duck/Moscow/5586/2018 | + | + | − | − | H1N2 |
| 49 | A/duck/Moscow/5662/2018 | + | + | − | − | H1N2 |
| 50 | A/duck/Moscow/5712/2019 | + | + | − | − | H11N6 |
| 51 | A/duck/Moscow/5743/2019 | + | + | − | − | H1N1 |
| 52 | A/duck/Moscow/5744/2019 | + | + | − | − | H1N1 |
| 53 | A/duck/Moscow/5881/2021 | + | + | − | − | H3N2 |
| 54 | A/duck/ Moscow/5897/2021 | + | + | − | − | H3N8 |
| 55 | A/duck/ Moscow/5908/2021 | + | + | − | − | H3N8 |
| 56 | A/duck/Moscow/6103/2022 | + | + | − | − | H3N8 |
| 57 | A/duck/Moscow/6104/2022 | + | + | − | − | H3N8 |
| 58 | A/duck/Moscow/6105/2022 | + | + | − | − | H3N8 |
| 59 | A/duck/Moscow/6106/2022 | + | + | − | − | H3N8 |
| 60 | A/duck/Moscow/6130/2022 | + | + | − | − | H3N8 |
| 61 | A/duck/Moscow/6131/2022 | + | + | − | − | H3N8 |
| 62 | A/duck/Moscow/6133/2022 | + | + | − | − | H4N6 |
| 63 | A/duck/Moscow/6134/2022 | + | + | − | − | H3N8 |
| 64 | A/duck/Moscow/6135/2022 | + | + | − | − | H6N2 |
| 65 | A/duck/Moscow/6147/2022 | + | + | − | − | H3N8 |
| 66 | A/duck/Moscow/6454/2023 | + | + | − | − | H11N9 |
| 67 | A/duck/Moscow/6455/2023 | + | + | − | − | H11N9 |
| 68 | NDV/duck/Moscow/3604/2008 | − | − | + | − | AOAV-1 |
| 69 | NDV/duck/Moscow/3639/2008 | − | − | + | − | AOAV-1 |
| 70 | NDV/duck/Moscow/3650/2008 | − | − | + | − | AOAV-1 |
| 71 | NDV/duck/Moscow/3660/2008 | − | − | + | − | AOAV-1 |
| 72 | NDV/chicken/Moscow/6081/2022 | − | − | + | − | AOAV-1 |
| 73 | APMV4/duck/Moscow/3575/2008 | − | − | − | + | APMV-4 |
| 74 | APMV4/duck/Moscow/3679/2008 | − | − | − | + | APMV-4 |
| 75 | APMV4/duck/Moscow/4096/2010 | − | − | − | + | APMV-4 |
| 76 | APMV4/duck/Moscow/4523/2011 | − | − | − | + | APMV-4 |
| 77 | APMV4/duck/Moscow/4526/2011 | − | − | − | + | APMV-4 |
| 78 | APMV4/duck/Moscow/4572/2011 | − | − | − | + | APMV-4 |
| 79 | APMV4/duck/Moscow/4571/2011 | − | − | − | + | APMV-4 |
| 80 | APMV4/duck/Moscow/4696/2011 | − | − | − | + | APMV-4 |
| 81 | APMV4/duck/Moscow/5268/2016 | − | − | − | + | APMV-4 |
| 82 | APMV4/duck/Moscow/5745/2019 | − | − | − | + | APMV-4 |
| 83 | APMV4/duck/Moscow/6333/2022 | − | − | − | + | APMV-4 |
In columns A, B, C, and D: fetuin binding (A), anti-AIV antibodies binding (B), anti-NDV antibodies binding (C), and anti-APMV-4 antibodies binding (D).
Subtyping of influenza viruses in a combined test with fetuin and mouse sera against influenza viruses of different subtypes
The combination of binding of viruses to the universal receptor fetuin and detection using specific antibodies simplifies the determination of subtypes of the tested viruses. The example of A/duck/Moscow/6454/2023 virus subtyping is presented in Figure 2. The virus subtype (H11N9) was subsequently confirmed by sequencing.
Figure 2.
A readout of a plate where VAF of A/duck/Moscow/6454/2023 virus bind of antibody to viruses of different subtypes. Column A-G of fetuine-coated plates were covereded with A/duck/Moscow/6454/2023 VAF. Column H without virus served as control. Tree-fold dilutions of immune mouse serum were added into rows. At the next stage, plates were covered with antibodies against mouse immunoglobulins conjugated with HRP. After washing, a color reaction was carried out.
Detection of paramyxoviruses
The following antibodies were obtained for the detection of paramyxoviruses:
1) IgY against NDV
2) IgY against APMV-4
3) mouse antibodies against NDV.
4) mouse antibodies against APMV-4.
IgY was partially purified by precipitation with 25% ammonium sulfate and used to coat 96-well plates. Mouse antibodies were used as secondary antibodies, which were then detected using antibodies against mouse immunoglobulins conjugated with HRP.
All VAFs with NDV viruses were positive in the test with primary IgY against NDV and secondary antibodies against NDV, while APMV-4 containing VAFs were negative in that test and positive in the test with primary IgY against APMV-4 and secondary antibodies against APMV-4 (Fig. 3).
Figure 3.
A representative readout of plates where samples of VAFs, were tested for fetuin binding, anti-NDV antibody binding, and anti-APMV-4 antibody binding. Six column of plates were coated with: fetuine (A), IgY against NDV (B) and IgY against APMV-4 (C). Columns G and H were no coated. Undiluted VAFs were added into columns F, G and H. Two-fold dilutions of VAFs were added into columns A-F; same on all plates. At the next stage, plates were covered with: fet-HRP (A), mouse antibodies against NDV (B) and mouse antibodies against APMV-4 (C). After that, plate A was ready for color reaction; while plates B and C were covered with antibodies against mouse immunoglobulins conjugated with HRP. After washing, a color reaction was carried out.
Six columns of plates were coated with: fetuine (A), IgY against NDV (B), and IgY against APMV-4 (C). Columns G and H were not coated. Undiluted VAFs were added into columns F, G, and H. Two-fold dilutions of VAFs were added into columns A-F; same on all plates. At the next stage, plates were covered with: fet-HRP (A), mouse antibodies against NDV (B), and mouse antibodies against APMV-4 (C). After that, plate A was ready for color reaction; while plates B and C were covered with antibodies against mouse immunoglobulins conjugated with HRP. After washing, a color reaction was carried out.
Detection of NDVs with the anti-NDV IgY conjugate with HRP
The increasing number of New Castle diseases in Russia has raised the challenge of strengthening the NDV detection method. To this end, we synthesized a conjugate of anti-NDV with HRP (aNDV-HRP). Using such a conjugate, virus detection takes place in three stages, as well as the detection of influenza viruses by FB-test. This made it possible to testing of influenza viruses and paramyxoviruses on one plate.
So, we coated half of the plate with fetuine, and another half with IgY against NDV. After washing with water and drying, the plate could be stored at –20°C for years. For virus detection, the plate was blocked with BSA solution, and 11 VAFs were added into rows 2-12; Row 1 without virus was used as a control. In the next step, the first half of the plate was covered with fet-HRP, and another half with aNDV-HRP. All VAFs with AIVs were positive in FB text. All VAFs with NDV viruses were positive in the test with primary IgY against NDV and aNDV-HRP. All negative VAFs contained APMV-4 (Fig. 4).
Figure 4.
A representative readout of a plate where samples of VAFs were tested for fetuin binding and anti-NDV antibody binding. Column A-D were coated with fetuine, and Column E-H were coated with IgY against NDV. VAFs diluted for hemagglutination titer 32 were added into rows 2-12. In the next step, columns A-D were covered with Fet-HRP, and columns E-H were covered with aNDV-HRP. After washing, a color reaction was carried out.
Columns A-D were coated with fetuine, and Columns E-H were coated with IgY against NDV. VAFs diluted for hemagglutination titer 32 were added into rows 2-12. In the next step, columns A-D were covered with Fet-HRP, and columns E-H were covered with aNDV-HRP. After washing, a color reaction was carried out.
Validation of the method by comparing the test results with the results of strain sequencing
All hemagglutinating agents were processed according to the following protocol: first, the ability to bind to fetuin was checked. Then, positive samples were tested with antibodies to AIV of different subtypes, and negative ones with antibodies to NDV and APMV-4. After that, PCR was performed with the corresponding primers and the resulting fragment was sequenced. Typing was performed according to the obtained sequence.
The analysis of 83 viruses isolated in Moscow in 2006-2023 is presented in Table 1. In all cases, the sequencing results coincided with the results of the fetuin and antibody binding test.
Discussion
Since 2006, we have been studying the diversity of AIVs and APMVs in the Moscow region. During monitoring, three groups of hemagglutinating viruses were isolated from bird: AIV, NDV, and APMV-4 [32,9]. All isolates were partially or completely sequenced. Preliminary identification of the groups to which the virus belongs allowed for saving labor and primers when setting up PCR.
Our method is less specific and less sensitive than numerous tests using monoclonal antibodies. We deliberately created a test with broad specificity, covering the entire group of viruses. To obtain antibodies from egg yolks, we immunized hens successively with two different viruses of the same group. We did not need high sensitivity, since we infected chicken embryos with the collected samples, in which the virus multiplied to high concentrations.
The most modern and advanced test system is gold immunochromatographic strips, with which the virus can be identified in 10 minutes with high sensitivity. Such strips are useful in poultry farms, where when birds are sick, a suspicion immediately arises regarding a possible pathogen—the strip must answer the question—is this pathogen present in the sick bird.
A completely different situation occurs when monitoring the environment. Positive samples can contain any virus; we have had to isolate AIV, NDV, and APMV-4 simultaneously in one place. Several strips must be used for each sample until a positive result is obtained.
The advantages of our test are its low cost and ease of production and implementation. The test does not use monoclonal antibodies; the test does not require special equipment, even a reader for 96-well plates is not necessary, since the result is read with the naked eye. The cost of the analysis is almost exhausted by the cost of the 96-well plate, since the other components are very cheap, and on one plate you can check 11 samples in one experiment.
The versatility of the FB test for influenza viruses has been demonstrated in our previous works [33–36]. All influenza viruses we tested that grew on chicken embryos are positive in this test. Only one group, namely the post-1997 H3N2 human influenza viruses, which did not grow on chicken embryos and did not agglutinate chicken red blood cells well, did not bind to fetuin [37]. However, when monitoring viruses from wild birds, a positive signal in the FB test always indicated AIV, and hemagglutinating but negative viruses in the FB test were always subsequently identified as paramyxoviruses [32].
Conclusion
Circulation of highly pathogenic H5N1 viruses in Europe and numerous outbreaks of highly pathogenic Newcastle disease virus in Africa, Asia, and Russia set the task of creating a simple, fast, and inexpensive virus detection method. The method we have developed allows us to detect and differentiate AIVs, NDVs, and APMV in the field and in small, poorly equipped laboratories.
Acknowledgments
We gratefully acknowledge all data contributors, i.e., the authors and their originating laboratories responsible for obtaining the specimens and their submitting laboratories for generating the genetic sequence and metadata and sharing via the Genebank, on which this research is based.
Conflicts of interest
The authors declare no conflict of interest.
Funding
This research received no external funding.
Authors contribution
All authors contributed equally to work.
Institutional Review Board Statement
The study was conducted according to the guidelines of the European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes, Strasbourg, 18 March 1986. The study design was approved by the Ethics Committee of the Chumakov Federal Scientific Center for the Research and Development of Immune-and-Biological Products, Village of Institute of Poliomyelitis, Settlement “Moskovskiy”, 108819 Moscow, Russia (Approval #4 from 7 December 2019).
