Introduction
Duck plague (DP), also known as duck viral enteritis (DVE), is one of the most infectious and lethal diseases in ducks. It is caused by a double-stranded DNA virus belonging to the genus Mardivirus of the family Herpesviridae [1]. Ducks, geese, and swans under the family Anatidae are naturally susceptible to duck viral enteritis virus (DVEV) infection. The DVEV has a worldwide distribution, and the migratory waterfowl play a vital role in spreading the disease as they are asymptomatic carriers. Ducks recovered from DP can act as a reservoir for up to 1 year [2,3]. Soil and water may be contaminated with DVEV-infected decaying duck carcasses and shedding of virus from recovered ducks. The contaminated water is the primary source of transmission of DVEV to the susceptible waterfowl of the Anatidae family. The DVEV can be spread through the eggs of the infected ducks [3,4]. The incubation period of this disease is 3–7 days [5]. The infection starts as young as 1 week in old birds [4]. Within an outbreak area, direct contact with the infected birds is the main mode of transmission of the virus to uninfected ducks [6].
The outbreaks of DP have been regularly observed throughout the year, except in August and September [4]. The highest outbreaks of DP have been reported from March to June, approximately 86%. The first sign of DP is sudden and persistent increases in flock mortality. Signs of DP include photophobia, partly closed eyelids, severe thirst, weight loss, ataxia, nasal discharge, tremors, wing drooped down, watery diarrhea, and prolapse of the penis in males [7]. The range of morbidity and mortality rates in DP-affected flocks is within 5%–100% [8]. The DP is responsible for a significant reduction in egg production and hatchability as well as the condemnation of carcasses that can lead to major economic losses in duck farm enterprises across the world.
On post-mortem, vascular damage, internal hemorrhages, lesions in lymphoid organs, digestive mucosal eruptions, degenerative lesions in parenchymatous organs, petechial hemorrhage in the conjunctivae, trachea, pharynx, and intestine are seen in DP-infected ducks [7]. Profuse bleeding within the internal cavity of the body, gastrointestinal tract, spleen, liver, heart, and pericardium are also observed [9]. Initial diagnosis of DP can be made by observing characteristic gross pathological findings along with clinical signs of the ducks. The liver, spleen, bursa of Fabricius, kidneys, peripheral blood lymphocytes, and cloacal swabs of infected and dying birds are suitable specimens for the isolation and identification of DVEV [10]. Confirmatory diagnosis of DP can be done by serological tests, isolation of DP virus from the clinical specimens, and molecular detection by polymerase chain reaction (PCR) assay [11].
In Bangladesh, DVEV was first detected and isolated by Sarker [12]. The disease is endemic in Bangladesh and causes 60%–75% mortality in ducks [13]. In China, DVEV was reported in 1957 [14]. The prevalence of DVEV in waterfowl in southern China was 3.8% [15]. In Vietnam, DVEV causes significant economic losses in the poultry sector [4].
The control of DP is considered one of the most critical challenges. To control DP regular surveillance of DP outbreaks in duck farms as well as isolation and characterization of field DVEV isolate from the natural outbreaks are essential. The objective of the present study was the isolation and molecular characterization of DVEV isolated from the natural outbreak of DP on commercial duck farms in three districts of Bangladesh.
Materials and Methods
Study area
This study was conducted on three commercial duck farms located at Mohanganj upazila of Netrokona district (Latitude: 24.934725, Longitude: 90.751511), sadar upazila of Mymensingh district (Latitude: 24.743448, Longitude: 90.398384), and sadar upazila Nilphamari district (Latitude: 25.84828, Longitude: 88.941413) (Fig. 1). Natural outbreaks of DP occurred on these commercial duck farms between February and June 2018. The flock size of the DP-affected duck farms was 800 in Netrokona, 2,000 in Mymensingh, and 1,500 in Nilphamari. The affected flock manifested the clinical signs of ocular and nasal discharge, anorexia, depression, diarrhea, extreme thirst, ataxia, and death. The breed of the duck of the DP-affected farm was Khaki Campbell. The ducks were reared in a semi-scavenging system. At night, they were kept in the house. Extra feed and water were provided during the morning and evening. The ducks of all three farms were not immunized by DP vaccines. Morbidity and mortality rates of the DP-affected duck flocks were recorded. The total number of illness cases divided by the entire population yields the morbidity rate. To find the mortality rate for a given population, divide the total number of deaths by the size of the population.
Sample collection
Dead ducks (n=42) were collected from natural outbreak DP on three commercial duck farms located in Netrokona (n=14), Mymensingh (n=14), and Nilphamari (n=14) districts. The DP-affected flock’s size ranged from 800 to 2,000, and the ducks’ ages ranged from 21 days to 1 year. At the beginning of the outbreak, dead carcasses of ducks were transported to the Department of Microbiology and Hygiene, Bangladesh Agricultural University (BAU), Mymensingh using ice boxes for post-mortem examination and virological analysis.
Figure 1.
Map of the study area.
Post-mortem examination and collection of clinical specimens
A detailed post-mortem examination was carried out to observe gross lesions including enlargement of the liver, spleen, and hemorrhage in the liver, spleen, and trachea. Clinical specimens such as liver, spleen, and trachea were collected. Gross pathological lesions of these visceral organs were recorded.
Preparation of viral inoculum
Pestle and mortar were used as a grinder to prepare tissue homogenate from liver and spleen samples after being cut into small pieces. 10% tissue homogenates were prepared using phosphate-buffered saline and centrifuged using a centrifuge machine (Kubata, Tokyo, Japan) at 4,000 rpm for 10 minutes [10]. The antibiotic–antimycotic (gentamycin–amphotericin) treated supernatant was taken as a viral inoculum. For the sterility test, antibiotic-treated inocula were cultured on blood agar. Sterile inocula were stored at −80°C.
Isolation of virus
The contamination-free viral inoculum was injected into 9–13 days embryonated duck eggs via the chorioallantoic membrane (CAM) route [10,11] and kept for incubation at 37°C for 3–8 days. Embryos of ducks that died before 24 hours of incubation were discarded. To isolate the DVEV, the CAM from dead embryos was collected.
Molecular detection of virus
The viral DNA was extracted from the liver, spleen, and CAM homogenate of duck embryo using a commercial kit (Gene Proof, Brno, Czech Republic) following the manufacturer’s guidelines. Extracted DNA was used as a template for PCR. Molecular detection of DVEV was done by PCR targeting the amplicon size of 446 bp of the DNA polymerase gene of DVEV [16,17].
Phylogenetic analysis
The phylogenetic tree was built to identify the genetic relationship of local DVEV isolates with that of the global DVEV found at GenBank. A Part of the DNA polymerase gene (446 bp) was amplified by PCR and sequenced from a commercial company (Ethical Scientific, Kuala Lumpur, Malaysia) by Sanger’s method. The sequences were deposited into the GenBank with the accession no MT066397, MT066398, and MT066399. The nucleic acid sequences of three local DVEV isolates (MT066397, MT066398, and MT066399) were aligned with the available sequence of DVEV isolates published at the GenBank, using MEGA11: Molecular Evolutionary Genetics Analysis Version 11. The phylogenetic tree was constructed by neighbor-joining methods using MEGA 5 software (Pennsylvania State University, Pennsylvania) [18].
Results
Clinical signs
The clinical signs that were seen in the ducks were ataxia, ocular and nasal discharge, ruffled feathers, anorexia, difficulty in breathing, greenish diarrhea, excessive thirst, depression, and death.
Morbidity and mortality rates
The highest morbidity (60%) and mortality (46.7%) of DP-affected farms was observed in Kishoregonj Nilphamari. The morbidity and mortality data of the DVEV-infected ducks in three districts are given in Table 1.
Post mortem findings
The gross pathological lesions observed in dead ducks during post-mortem examination included enlarged hemorrhagic liver, spleen, and annular hemorrhagic ring in the trachea (Fig. 2), which are characteristic lesions of DVEV infection.
Isolation of virus
Molecular detection of DVEV
The viral DNA extracted from the liver, spleen, and CAM homogenate were effectively amplified in a PCR assay with the production of 446 bp fragments of the DNA polymerase gene of DVEV (Fig. 5). The molecular detection of DVEV in liver and spleen homogenate was 100% in ducks in the Netrokona district (Table 2).
Phylogenetic analysis
The phylogenetic tree revealed sequence similarities of the studied DVEVs (GenBank accession no. MT066397, MT066398, and MT066399) to the anatid herpesvirus isolates previously reported from Bangladesh, Vietnam, China, and India (Fig. 6). The phylogenetic tree was constructed using the following sequence data:
1 gaaggcgggtatgtaatgtacattccatttactggaaatgccgtacatctacactatcgt
61 ctcatcgactgccttaaatctgcttgccggggataccgtctaatggctcatgtttggcat
121 tctacattcgtacttgtcgtgaggcgcgaccgcgaacggcaaactgacgtggacagcgta
181 ccacagataagtattgaagatatttattgtaaaatgtgcgaccttaatttcgatggggaa
241 cttctgctagaatatcgaaagctctacgcagcttttgacgattttcctcctcctcgctga
301 gtggcatccctgggtacaagcgcacttctgcaaacccggccgaagatagcagtgctgcgg
361 tttcgtcactctcacagtatgtttctggaataaagcgttttaaaacagcttccgaagttt
421 tgtgatcattaccgaatagagccttg
Table 1.
Morbidity and mortality of duck flock in Netrokona, Mymensingh, and Nilphamari districts of Bangladesh.
| Study areas | Flock size | No. of affected ducks/morbidity rate (%) | No. of dead ducks/mortality rate (%) |
|---|---|---|---|
| Mohanganj, Netrakona | 800 | 350 (43.75) | 200 (25) |
| Tarati, Mymensingh | 2,000 | 700 (35) | 300 (15) |
| Kishoregonj, Nilphamari | 1,500 | 900 (60) | 700 (46.7) |
Figure 2.
Pathognomonic lesions of a death suspected to be infected duck with DVEV. (A) Dead duck, (B) hemorrhagic annular bands on the trachea, (C) liver enlarged and pale in color with pinpoint hemorrhages, (D) and multiple petechial hemorrhages on the surface of the dark enlarged spleen.
Figure 3.
Degeneration of blood vessels of CAM in a 13-day-old embryonated duck egg (left). Normal blood vessels were seen in an uninoculated 13-day-old control embryonated duck embryo (right).
Figure 4.
Dwarfisms were seen in a DVEV-infected 13-day-old embryonated duck embryo (left). Duck embryo was found normal in the case of uninfected control (right).
Discussion
The DP is an economically significant disease of ducks in Bangladesh. The economic losses of DP result from an increase culling rate of meat ducks and a drop in egg production in lying and breeding ducks [4]. Regular monitoring of the field outbreak of DP is essential to undertake an effective control measure. The current study was undertaken to isolate, identify, and characterize DVEV from field outbreaks of DP on duck farms located in the Mymensingh, Netrokona, and Nilphamari districts of Bangladesh.
DP outbreaks mostly occurred in the spring season [19]. The current study observed the outbreaks of DP in the duck farms from March to June. In the spring season ducks were under huge stress due to physiological pressures in the length of daylight and the starting of breeding, which caused virus release into the environment and lead to disease outbreak. Migratory waterfowl are known as the asymptomatic natural reservoirs of DVEV. In Bangladesh, migratory waterfowl come to the lake, river, bills, and haors in the winter season and stay up until the end of March. Ducks in the study areas were frequently mixed with migratory waterfowl while scavenging on the pond, river, and hoar. Ducks might get infected with DVEV either by direct contact with migratory waterfowl or by drinking the DVEV-contaminated water. White Pekin, Khaki Campbell, Indian Runner, and Muscovy ducks are susceptible to DVEV infection [20,21]. In the current study, DP outbreaks occur in the Khaki Campbell breed of ducks. This breed of duck is popular among farmers in the study area due to its high egg-production ability.
Table 2.
Molecular detection of DVEV from clinical specimens of ducks by PCR assay.
| Study area | No of dead ducks | Name of sample | No. of sample tested | Confirmation of DVEV by PCR assays | |
|---|---|---|---|---|---|
| No. of PCR positive samples (%) | Overall occurrence of DVEV (%) | ||||
| Netrokona | 14 | Liver | 14 | 14 (100.00) | 42.85 |
| Spleen | 14 | 14 (100.00) | |||
| CAM | 14 | 14 (100.00) | |||
| Mymensingh | 14 | Liver | 14 | 1 (7.14) | |
| Spleen | 14 | 1 (7.14) | |||
| CAM | 14 | 1 (7.14) | |||
| Nilphamari | 14 | Liver | 14 | 3 (21.42) | |
| Spleen | 14 | 3 (21.42) | |||
| CAM | 14 | 3 (21.42) | |||
DEEV: duck virus enteritis virus, PCR: polymerase chain reaction assay, CAM: chorioallantoic membrane.
Figure 5.
Molecular detection of DVEV by PCR assay. Lane M: 100 bp ladder, lane 1–3: Viral DNA extracted from liver, spleen, and CAM homogenate, lane PC: positive control, lane NC: negative control.
Figure 6.
Phylogenetic analysis based on partial sequences (446-bp) three sequences reported in this study (MT066397, MT066398, and MT066399) that are found similar to the DVEV previously reported in Bangladesh, Vietnam, China, and India. The tree is constructed by neighbor-joining methods.
The clinical signs of DP include partially closed eyelids, anorexia, increased thirst and ataxia, and decreased egg production [22]. The affected duck in the study areas manifested the clinical signs of greenish watery diarrhea, photophobia, prolapse of the penis, anorexia, and ataxia, which are characteristic signs of DP. A study conducted by King et al. [23] recorded appetence, thirst, ataxia, ruffled feathers, nasal discharge, watery diarrhea, and reduced egg production in DVEV-infected duck flocks. The DP has been documented in domestic ducks and ducklings ranging in age from 7 days to adult breeders [10]. The fatality of adult breeder ducks is higher than that of young ducks [24]. In this study, the mortality rate was 25% in ducks belonging to age between 6 months and 1 year. However, the mortality rate was 46.7% in ducklings belonging to 3 weeks of age. The increased or decreased mortality rate depends mainly on the virulence of the DVEV and host immunity. In the present study, overall, 35%–60% morbidity and 15%–46.7% mortality in DP-affected flocks were recorded. The mortality of ducks in the Netrokona district of Bangladesh was recorded as 27.1%. In contrast, in indigenous growing ducks, only 6%–9% mortality was reported due to the infection of DVEV [25,26].
The DVEV is a pantropic virus that can infect several organs of ducks and produce pathological lesions [4]. The virus multiplies in the mucosal epithelial cells of the esophagus and digestive tract after entering a susceptible host. It then moves on to the thymus, bursa of Fabricius, spleen, and liver [4,27]. Infection with DVEV is strongly suggested by severe enteritis, hemorrhage in the gut, body cavities, heart, pericardium, liver, and spleen, and plaques in the esophagus and intestine [28–30]. In this study, post-mortem findings were enlarged hemorrhagic liver and spleen, abdominal hemorrhage, and annular rings in the trachea. Several researchers also observed similar post-mortem lesions in DVEV-infected ducks [20,29,31].
The occurrence of DVEV from isolated samples was 42.58%. The prevalence and mortality rate in this study was higher than most of the investigators [11,29] which might have resulted from the non-vaccination of ducks with the DP vaccine on the affected farms. The unawareness of the farmers about the DP vaccine, improper timing of vaccination, and a poor immune response following vaccination might cause DP outbreaks [32].
The sensitive and accurate method for the detection of DVEV is PCR only [32]. In this study, molecular detection of DVEV in the liver, spleen, and CAM homogenate was performed by PCR [16]. The PCR assay is successfully amplified by targeting the 446 bp segment of the DNA polymerase gene of DVEV. Similar PCR results were also reported by other investigators [20,33]. In this research, the experimental infection caused the duck embryos to die 2–5 days later. Dwarfism of the embryo and blood vessel degeneration in the CAM were observed. The same conclusions were also found by other investigators [29,33,34].
In this study, the PCR-based detection of DVEV varied between 7.14% and 100% across the three districts. Despite the samples being collected from suspected field outbreaks of DP, the observed variation may be attributed to differences in viral concentration in the tissue samples or duck mortality may be attributed to infections other than DP.
The genetic link between the DVEV isolates and the isolates found at GenBank was ascertained through phylogenetic analysis. The sequenced strains of the three DVEVs (MT066397, MT066398, and MT066399) were shown by a phylogenetic tree to be very close to each other in the nucleotide sequence of DEV isolates originating from Bangladesh, Vietnam, and China. A phylogenetic study found genetic similarity of Bangladeshi DVEV isolates originating from China [11].
Conclusion
In conclusion, this study successfully isolated and identified the circulating DVEV responsible for the fatal outbreaks of DP in commercial duck farms in Bangladesh. The molecular detection and genetic characterization of the virus through PCR and phylogenetic analysis confirmed a 100% similarity to DVEV isolates previously reported in Bangladesh, Vietnam, and China. The observed gross lesions in affected ducks, along with the experimental inoculation of duck embryos, further supported the pathogenicity of the identified DVEV. This research contributes valuable insights into the epidemiology and genetic characteristics of DVEV, aiding in the understanding and management of DP outbreaks.
Recommendation
Data suggested that the DVEV is prevalent in the study area, which causes huge economic losses in the duck farm. The implementation of control measures against DVEV by vaccination and biosecurity needs to be undertaken in the study areas.
Acknowledgments
The authors acknowledge the farmers for providing dead duck samples. The Bangladesh Agricultural Research Council (BARC) provided funding for the study project (NATP Phase-2, Grants no.LS-367).
Conflicts of interest
The authors declare no competing interest.
Author contributions
Md. Jahidul Islam: Collection of samples, conducted experiment, data analysis, writing manuscript. Md. Mohirul Islam: Conducted experiment, data analysis, writing manuscript, Md. Sadequl Islam: Collection of samples, data analysis, manuscript writing. Md. Zaminur Rahman: Data analysis and review and writing the manuscript. Palash Bose: Phylogenetic analysis and writing the manuscript. Mohammed Rafiqul Islam: Designing the experiment, data analysis, and writing the manuscript. Mst. Minara Khatun: Easing the experiment, data analysis, and writing the manuscript. Md. Ariful Islam: Conceptualization, experimental design, data analysis, and writing and reviewing the manuscript.
