Alchornea laxiflora as therapeutic agent in the treatment of Trypanosoma brucei brucei infection using experimental wistar rats; invivo and gene expression studies

Catherine Olusunmibola Durojaye; Olusola Olalekan Elekofehinti; Innocent Bamidele Osho; Stephen Olusola Abodunrin

doi:10.5455/JRVS.20230812093455

ABSTRACT

Aims:

African trypanosomosis is a zoonotic tropical disease of SubSaharan Africa. It’s etiology is a group of extracellular protozoans of the genera Trypanosoma which has numerous species including Trypanosoma brucei brucei. Inavailability of vaccines and numerous side effects arising from few available antitrypanosomal drugs gives the indication for search for local alternatives. This experimental study investigates the antitrypanosomal efficacy of chloroform extract of Alchornea laxiflora leaves in Wistar albino rats infected with T. brucei brucei.

Place and Duration of Study:

Animal Parasitology and Microbiology Research Unit, Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria, between July and November, 2022.

Methodology:

Thirty-six rats of both sexes were infected with T. brucei brucei and treated with A. laxiflora extracts intraperitoneally at dosages of 100, 200, and 400 mg/kg for three consecutive days. Diminacene aceturate at 3.5 mg/kg as single dose was used as positive control. Daily parasiteamia, rectal temperature and body weight were monitored for 26 days. Antioxidant [superoxide dismutase (SOD), catalase (CAT), and nuclear factor erythroid 2-related factor 2 (Nrf2)] and proinflammatory [tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6)] gene expressions were determined.

Results:

Treatment with A. laxiflora caused significant (p < 0.05) decrease in parasitemia of infected rats compared to negative control. Increase in weight gain was recorded after the initial weight loss post infection. There was prolongation of survival days to 22 days at 400 mg/kg treatment dose compared to 7 days in the untreated control. Significant (p < 0.05) dose dependent upward regulation of SOD, CAT, and Nrf2 antioxidant genes and down-regulation of TNF-α and IL-6 inflammatory genes were observed in all treatment groups compared to the untreated control in the spleen and liver.

Conclusion:

These observations suggest that A. laxiflora extract possess excellent antitrypanosomal properties with the downregulation of proinflammatory genes and up-regulation of antioxidant genes.

KEYWORDS Alchornea laxiflora; antioxidant genes; invivo antitrypanosomal; proinfammatory genes; Trypanosomoma brucei brucei

Introduction

The African animal trypanosomiasis (AAT) has been identified as a significant impediment to the attainment of sustainable livestock production and food security. The World Health Organization has recognized AAT as a crucial contributor to underdevelopment in the sub-Saharan African region [1]. In Nigeria, there is evidence of re-emergence of trypanosomiasis as a significant livestock ailment, with notable clinical implications for small ruminants and its spread into areas formerly considered free from tsetse flies [2]. The disease is characterized by several clinical features, such as intermittent fever, anemia, anorexia, poor hair coat, emaciation, lethargy, enlarged lymph nodes, abortion, infertility, decreased milk production, submandibular edema, ascites, ocular discharge, and mortality [3].

The present treatment regimen for animal trypanosomiasis comprises the administration of homidium, isometamidium, and diminazene aceturate. Each of these drugs presents one or more problems, including high cost, significant toxicity, the requirement for parenteral administration, and the emergence of parasite resistance [4]. The therapeutic effectiveness of various plant parts in the treatment of trypanosomiasis has been documented by numerous researchers [5–7].

Alchornea laxiflora (Benth.) Pax & K. Hoffm. (Euphorbiaceae) is a shrub that exhibits a wide distribution in several regions of the African continent. The distribution range of this species spans from eastern Nigeria to Ethiopia and extends southward to the Democratic Republic of Congo. It is found throughout East Africa, including Zimbabwe, Mozambique, the northeastern regions of South Africa, and Swaziland. The maximum height that it can get is 6 m [8]. Based on the information provided by “The Plant List” (http://www.theplantlist.org), it can be observed that the Alchornea genus encompasses a total of 55 distinct species. The nomenclature of this entity varies across Africa, with different vernacular names being employed according to the region’s cultural and ethnic heterogeneity [9]. Several indigenous African names may be found in different regions of the continent. For instance, in the Edo culture, the name Uwenuwen is prevalent, while in the Igbo culture, the name Ububo is commonly used. Similarly, in the Yoruba culture, the name Ewe pepe holds significance, while in the Ibibio culture, the name Nwariwa is prominent. Additionally, in the Hausa culture, the name Fura amarya is frequently encountered [9,10].

Methods and Materials

Collection of plant leaves

The leaves of A. laxiflora Benth were collected from their indigenous environments in Akure, Ondo State, Nigeria, during daylight hours, with the assistance of technicians from the Department of Forestry and Wood Technology at the Federal University of Technology, Akure. The specimens were verified and confirmed as authentic by the Department of Pharmacognosy, the Faculty of Pharmacy, Obafemi Awolowo University, Ile Ife. This authentication was accompanied with a voucher number, FPI 2401.

Plant preparation and extraction

The leaves underwent a process of being rinsed with distilled water, subsequently dried in ambient air, and then pulverized into a powdered form using an electric blender. The powdered botanical specimen was soaked in chloroform at a ratio of 1:4 and, thereafter, left undisturbed for duration of 72 hours. Following this period, the mixture was subjected to filtration and the filtrate was dried using a rotary evaporator in order to obtain a lyophilized chloroform extract of the leaves of A. laxiflora.

Fractionation of extract

The crude chloroform extract of A. laxiflora leaves were reconstituted in absolute ethanol and spotted on analytical thin layer chromatography (TLC) (silica gel G600, 0.25 mm thickness). The following solvent systems and ratios were used as mobile phase, and the eluent with optimum performance was adopted; chloroform/ethanol/methanol 1:2:2, chloroform/ethanol/ethyl acetate 2:1:2, chloroform/ethyl acetate/ethanol 2:1:2, chloroform/ethyl acetate/ethanol 1:1:1. After each separation, the TLC plate was exposed to iodine fumes in a chamber and the solvent system that gave the best resolution was adopted for column fractionation. Twenty grams of the extracts were chromatographed over silica gel column (100–200 mesh). The admixture was packed on a silica gel column (Merck, India) using chloroform/ethyl acetate/ethanol (2:1:2) solvent system. Approximately, 20 ml aliquots of eluent were collected while observing the distance travelled by the sample down the column. Bands of the same sample formed on TLC were also monitored. The fractions showing similar TLC mobility and band formation were pooled and the solvent was evaporated under a steady air current at room temperature. Method as described by Nwodo et al. [11].

Trypanosomes

Trypanosoma brucei brucei was obtained from the National Institute of Trypanosomosis Research, Vom, Jos, Nigeria. The parasites were serially passaged in a donor rat. Using “rapid matching” method as described by Herbert and Lumsden [12], the parasitemia of “donor rat” was estimated.

Experimental rats

This study utilized healthy adult Wistar albino rats of both genders, with weights ranging from 130 to 180 g. The animals were obtained from the Animal facility located at Obafemi Awolowo University in Ile Ife, Osun State, Nigeria. They were afterward housed in the animal facility of the microbiology and parasitology research unit of the Animal Production and Health department at the Federal University of Technology in Akure, Nigeria. The subjects had a 2-week acclimatization period and received care in accordance with international guidelines for the use and maintenance of experimental animals [13]. The animals were provided with a commercial ration for their diet and given unrestricted access to water.

Experimental design and treatment

The animals were randomly divided into six groups consisting six rats each as grouped below.

Group 1: Infected treated with fraction A3 of chloroform extract of A. laxiflora (ALF3) at 100 mg/kg.

Group 2: Infected treated with fraction A3 of chloroform extract of A. laxiflora (ALF 3) at 200 mg/kg.

Group 3: Infected treated with fraction A3 of chloroform extract of A. laxiflora (ALF 3) at 400 mg/kg.

Group 4: Infected treated with diaminazine aceturate at 3.5 mg/kg.

Group 5: Infected not treated control.

Group 6: Not infected not treated.

All rats in test groups for were infected intraperitoneally with 0.2 ml of diluted blood containing 1 × 10⁶ trypanosomes as adopted by Maikai et al. [14]. The animals were monitored for 3 days to establish parasitemia after which treatment began. Extracts were administered for three consecutive days while dinimazene aceturate was given at a single dose. All drugs were administered intraperitoneally. Surviving rats at the end of the 26 days experimental duration were sacrificed. Spleen and liver were collected and preserved in Trizol reagent for bio molecular studies.

Monitoring of parasitemia was performed daily until the 26th day [15,16].

Body weight of experimental animals was recorded on the day of parasite challenge and everyday thereafter for 26 days [17].

Rectal temperature was measured using digital rectal thermometer (Mettler Toledo, Switzerland) on the day of parasite inoculation and everyday, thereafter, for 26 days [18].

Isolation and purification of total RNA

The Trizol-preserved tissues were homogenized in an Eppendorf tube using plastic pestle to permit thorough exposure of the cell’s nucleus. The homogenized tissues were partitioned using chloroform as gradient separation medium. Isoamy alcohol was added as precipitating solution, after which the sample was treated with DNase (NEB) for 10 minutes before the RNA pellet was washed with ethanol to remove any DNA and phenol contamination, respectively. The obtained DNase free RNA was suspended in nuclease-free water. The purity was determined by measuring the absorbance at 260 and 280 nm, respectively [19].

Polymerase chain reaction (PCR) and amplification of gene of interest

The total RNA that was acquired was subjected to reverse transcriptase PCR (RT-PCR) in order to generate complementary DNA (cDNA). The process of converting RNA to cDNA was began by the enzyme reverse transcriptase [19]. Following the synthesis of cDNA, the amplification of the target genes was conducted using a designed and optimized set of primers (Table 1). This set of primers consisted of both forwards and reverse primers. The amplification process is catalyzed by the PCR Master Mix, utilizing the thermocycler (Eppendorf Mastercycler AG 22,331) Hamburg, for a total of 30 cycles.

Gel electrophoresis

The amplicons obtained from the PCR were subjected to assessment by electrophoresis on a 0.2% agarose gel. The gel was prepared using 0.5 × tris/borate/ethylenediamine tetraacetic acid (EDTA) buffer, which consisted of 2.6 g of Tris base, 5 g of Tris boric acid, and 2 ml of 0.5 M EDTA. The pH of the buffer was adjusted to 8.3 using a sodium hydroxide pellet. To visualize the DNA bands, 3 μl of EZ-vision (VWR Life Science) was added to the gel. The result was observed as bands using a blue-light-transilluminator. The intensity of the bands resulting from the agarose gel electrophoresis was quantitatively measured using the ImageJ software through densitometric analysis. A bar graph was utilized to display a representative snapshot of the data obtained from reverse transcription PCR-agarose gel electrophoresis. Figure 3a and b present the expression levels of T. brucei mRNA for VSG-like protein (SRA gene) in the spleen and liver, respectively, across all experimental groups.

Table 1.

List of designed, optimized, and synthesized primers specific for each gene.

S/N	Gene name	Forward primer	Reverse primer
1	TB (SRA)	GACGAAGAGCCCGTCAAGAA	CACTGGTTTTGGCTCCGTTG
2	GAPDH	GCAAGGATACTGAGAGCAAGAG	CATCTCCCTCACAATTCCATCC
3	TNFα	ACCACGCTCTTCTGTCTACTG	CTTGGTGGTTTGCTACGAC
4	IL-6	TCTCTCCGCAAGAGACTTCCA	ATACTGGTCTGTTGTGGGTGG
5	SOD	AGGGCCTGTCCCATGATGTC	AGAAACCCGTTTGCCTCTACTGAA
6	CAT	GATGGTAACTGGGACCTTGTG	GTGGGTTTCTCTTCTGGCTATG
7	Nrf2	CACATCCAGACAGACACCAGT	CTACAAATGGGAATGTCTCTGC

TB (SRA): T. brucei mRNA for VSG-like protein (sra gene); GADPH: Glyceraldehyde-3-phosphate dehydrogenase; TNFα: Tumor necrosis factor alpha; IL-6: Interleukin-6; SOD: Superoxide dismutase; CAT: Catalase; Nrf2: Nuclear factor erythroid 2-related factor 2.

Figure 1.

Invivo activity of fraction ALF3 of chloroform extract of A. laxiflora leaves on parasitemia in T. brucei brucei infected rats. ALF3A: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 100 mg/kg. ALF3B: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 200 mg/kg. ALF3C: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 400 mg/kg. DA: Diminacene aceturate at 3.5 mg/kg. INT: Infected not treated control. NINT: Not infected not treated control.

Statistical analysis

All data generated during the experiment were subjected to analysis of variance and the Duncan’s p-values less than 0.05 were considered statistically significant. Graphical illustrations were also represented using Microsoft excel software where necessary. Graph padprism version 7.04 was used to plot the graph for gel electrophoresis data.

Results

Effect of treatment on parasitemia

On day 5 from the commencement of treatment, there is significant (p < 0.05) difference in parasitemia level between all extract groups compared with positive and negative controls. There was consistent dose-dependent decrease in parasitemia in all extract treatment groups through day 21 (Fig. 1).

Effect of treatment on body weight

There is statistically significant (p < 0.05) body weight changes in all treatment groups from day 5 post treatment initiation compared with untreated control. By day 11, however, there was no significant difference between extract treatment groups and positive control compared with the not infected control groups (Table 2).

Effects of treatment on rectal temperature

On day 1 post treatment, there is significant difference in the rectal temperature (p < 0.05) between extract treatment group at 400 mg/kg compared to the controls. From day 7 to 21, there is no significant difference between all treatment groups and controls (Table 3).

Table 2.

Effect of treatment with fraction ALF3 of chloroform extract of A. laxiflora on body weight of T. brucei brucei infected rats.

	PI 7	PI 8	D1	D3	D5	D7	D9	D11	D13	D15	D17	D19	D21
ALF3A	148.51 ± 10.97	147.37 ± 10.07	145.96 ± 9.17^a	146.34 ± 8.31^a	148.92 ± 10.85^b	151.83 ± 12.67^b	155.24 ± 11.38^a	158.70 ± 13.57^a	162.15 ± 16.41^a	165.49 ± 14.51^a	168.37^a	171.21^a
ALF3B	148.55 ± 4.51	147.59 ± 6.01	146.37 ± 6.62^a	146.95 ± 5.98^a	149.69 ± 5.77^b	152.60 ± 6.62 ^ab	156.04 ± 9.62^ab	159.46 ± 9.96^a	162.87 ± 8.63^a	166.34 ± 7.81^a	169.46 ± 5.32^a	171.83 ± 0.57^a	174.88^a
ALF3C	148.97 ± 4.53	147.99 ± 5.18	146.89 ± 5.26^a	147.51 ± 5.20^a	150.26 ± 4.02^b	153.21 ± 4.17 ^ab	156.64 ± 3.69^ab	160.08 ± 2.41^a	163.49 ± 2.97^a	166.91 ± 2.15^a	170.20 ± 1.33^a	173.22 ± 1.50^ab	175.59 ± 1.03^a
DA	147.59 ± 3.67	146.90 ± 4.41	146.29 ± 3.81^a	148.12 ± 3.76^a	149.48 ± 2.20^b	152.44 ± 2.54 ^ab	156.05 ± 4.24^ab	160.68 ± 4.53^a	162.59 ± 5.63^a	166.96 ± 5.00^a	170.05 ± 6.69^a	174.91 ± 4.30^b	178.92 ± 5.89^a
INT	147.72 ± 3.35	146.71 ± 3.42	145.85 ± 3.91^a	142.37 ± 3.52^a	137.83 ± 2.74^a	130.36 ± 0.88^a
NINT	152.66± 3.69	154.44 ± 4.97	156.83 ± 5.48^b	159.36 ± 6.32^b	161.80 ± 6.36^c	163.02 ± 6.45^c	165.38 ± 6.23^b	168.33 ± 8.74^a	168.48 ± 7.52^a	170.91 ± 7.77^a	172.06 ± 9.13^a	176.43 ± 8.83^a	180.26 ± 9.40

^a,b,cMeans on the same column but with different superscripts are significantly different at 0.05.

ALF3A: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 100 mg/kg; ALF3B: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 200 mg/kg; ALF3C: Infected treated with fraction ALF3 of chloroform extract of A. laxiflora leaves at 400 mg/kg; DA: Diminacene aceturate at 3.5 mg/kg; INT: Infected not treated control; NINT: Not infected not treated control.

Table 3.

Effect of treatment with fraction ALF3 of chloroform extract of A. laxiflora on rectal temperature of T. brucei brucei infected rats.

	PI 7	PI 8	D1	D3	D5	D7	D9	D11	D13	D15	D17	D19	D20	D21
ALF3A	34.63 ± 0.43^ab	34.93 ± 0.55^a	35.90 ± 0.69^a	34.78 ± 0.61^ab	37.10 ± 0.75^c	36.97 ± 0.41^ab	37.25 ± 0.29^b	37.02 ± 0.21^b	37.37 ± 0.08^bc	37.08 ± 0.40^ab	36.70	37.50
ALF3B	35.10 ± 0.36^b	34.77 ± 0.74^a	36.42 ± 0.54^ab	35.62 ± 0.59^bc	37.02 ± 0.68^c	37.02 ± 0.88^ab	36.82 ± 0.58^ab	36.47 ± 0.79^ab	37.02 ± 0.36^ab	37.62 ± 0.31^b	36.94 ± 0.48^a	36.95 ± 0.78^a	37.00	37.30
ALF3C	34.80 ± 0.73^b	34.97 ± 0.69^a	36.95 ± 0.54^b	34.23 ± 0.91^a	35.60 ± 1.76^b	36.77 ± 0.72^ab	36.65 ± 0.40^ab	36.78 ± 0.46^ab	37.50 ± 0.11^c	37.22 ± 0.15^ab	37.15 ± 0.63^a	37.32 ± 0.62^a	37.76 ± 0.18^a	37.15 ± 0.47^a
DM	33.80 ± 1.06^a	34.87 ± 1.32^a	36.50 ± 0.41^ab	36.23 ± 1.00^cd	37.05 ± 0.21^c	36.45 ± 0.51^b	37.02 ± 0.61^ab	36.32 ± 0.43^a	36.60 ± 0.31^a	36.85 ± 0.63^a	36.45 ± 0.83^a	36.72 ± 0.61^a	36.90 ± 0.14^a	37.27 ± 0.32^a
INT	36.33 ± 0.73^c	34.65 ± 1.24^a	35.80 ± 0.28^a	35.88 ± 0.89^cd	36.50 ± 0.41^bc	37.65 ± 0.21^c
NINT	34.50 ± 0.48^ab	34.97 ± 0.79^a	38.00 ± 0.79^c	36.67 ± 0.72^d	33.55 ± 0.38^a	35.43 ± 0.48^a	36.53 ± 0.42^a	36.98 ± 0.46^b	36.95 ± 0.62^ab	36.67 ± 0.70^a	36.73 ± 0.86^a	36.72 ± 0.61^a	36.90 ± 0.14^a	36.95 ± 0.46^a

^a,b,cMeans on the same column but with different superscripts are significantly different at 0.05.

Effect of treatment on mean survival days

The average survival days of infected rats were increased to 22 days in 400 mg/kg of ALF3 fraction of chloroform extracts of A. laxiflora compared with 7 days in negative control group and 26 days in positive control groups (Fig. 2).

Figure 2.

Effect of A. laxiflora fraction ALF3 on mean survival days of rats infected with T. brucei brucei.

Effect of treatment with A. laxiflora on inflammatory genes of T. brucei brucei infected rats

Expression of gene coding for T. brucei (TB SRA) in the spleen and liver tissues are illustrated in Figure 3a and b, respectively. The effects of intraperitoneal treatment with A. laxiflora extract in T. brucei brucei infected rats on expression of inflammatory genes [tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6)] are illustrated as bar chart in Figure 4a–d for the splenic and liver tissues.

There is significant over-expression (p < 0.05) of TNF-α in the untreated (negative control) group relative to control group in both splenic and liver tissues. Significant (p < 0.05) downward regulation is observed in the spleen at all dose levels of the extract compared to the negative control (Fig. 4a). The expression of the TNF-α gene in the liver was significantly downregulated (p < 0.05) in groups treated with A. laxiflora extracts at 400 mg/kg compared to the positive control (Fig. 4b).

Figure 4c and d below shows the effects of treatment with A. laxiflora on the proinflammatory cytokines IL-6 in the spleen and liver of T. brucei brucei infected rats, respectively. Significantly, over-expression of IL-6 was observed in untreated group when compared to control group. However, a significant down-regulation of IL-6 was observed in all treatment groups when compared to negative control groups in both tissues. In the spleen at treatment with A. laxiflora at 400 mg/kg, there is significant downregulation of the gene compared to the positive control (Fig. 4c).

Effect of treatment with A. laxiflora on antioxidant genes T. brucei brucei infected rats

Results are as illustrated in bar charts in Figure 5a–f for expression of antioxidant genes in the spleen and liver tissues of rats treated with A. laxiflora extracts. There is under-expression of superoxide dismutase (SOD), catalase (CAT), and nuclear factor erythroid 2-related factor 2 (Nrf2) genes in untreated group in comparison to the control groups in both spleen and liver tissues. Significant (p < 0.05) dose dependent upward regulation of SOD, CAT, and Nrf2 genes were observed in all treatment groups compared to the untreated control in the spleen and liver.

Discussion

Over the past century, phytochemicals in plants have been a crucial channel for pharmaceutical innovation and significant scientific interest in the biological properties of these substances [20]. Alchornea laxiflora is highly abundant in Nigeria and its common use in the management of a number of animal disease conditions has been notable. The invitro antitrypanosomal activities of crude chloroform extracts of A. laxiflora has been reported [7]. Moving ahead from this reported study, the invivo antitrypanosomal effect of fractioned chloroform extracts of A. laxiflora leaves is being conducted at different treatment dose levels on T. brucei brucei infected rats.

Figure 3.

(a) Relative expression of TB (SRA) gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (b) Relative expression of TB (SRA) gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200 and 400 mg/kg.

The expression of TB (SRA) gene when compared to the control group is given in Figure 3a and b. Treatment of infected rats with varied doses of A. laxiflora extracts intraperitoneally showed significant down-regulation of TB (SRA) gene expression when compared to the untreated rats. This was probably possible due to the vast enormity of phytochemicals in A. laxiflora extract as earlier reported [7,21–23].

There is inverse relationship between level of parasitemia and weight loss or gain in the treatment groups of this study; a relationship that is positively dose dependent. This might be due to anorexia which is one of the clinical features of trypanosomosis but as parasitemia reduces in the treatment groups, a corresponding weight gain is recorded. Aremu et al. [24], reported a similar result using extracts of Moringa oleifera.

There was no significant increase in the mean daily rectal temperature of all extract-treated animals for this study. A characteristic sign and symptom of trypanosomosis in susceptible animals is the increase in body temperature [25]. Despite undulating parasitemia observed in rats treated with extracts of A. laxiflora, there was no conforming undulating pyrexia. This could indicate the presence of antipyretic compound in the plants which may be responsible for insignificant increase in mean rectal temperature of the test animals. Similar results have been reported by Ayawa et al. [6], and Durojaye and Osho [7]. There is significant (p < 0.05) difference in the survival days of infected rats treated with plant extracts when compared with the negative control.

Figure 4.

(a) Relative expression of TNF-α gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (b) Relative expression of TNF-α gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (c) Relative expression of IL-6 gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (d) Relative expression of IL-6 gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg.

Figure 5.

(a) Relative expression of SOD gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (b) Relative expression of SOD gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (c) Relative expression of CAT gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (d) Relative expression of CAT gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (e) Relative expression of Nrf2 gene in the spleen of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg. (f) Relative expression of Nrf2 gene in the liver of rats infected with T. brucei brucei and treated with A. laxiflora extract at 100, 200, and 400 mg/kg.

Dysregulation of cytokine network is a hallmark of African trypanosomiasis and excessive production of inflammatory cytokines, and the release of inflammatory mediators has been proposed as a major cause of death in infected animals [26]. TNF is one of the most crucial proinflammatory cytokines that confer immunity against African trypanosomiasis [27,28]. The overexpression of TNF-α and IL-6 genes in infected-untreated group with down regulation in extract treatment groups attests to the antiinflammatory properties of A. laxiflora which are crucial in the treatment of trypansomosis.

Oxidative stress and its careful management are also important as it is one of the most common means of defense employed by the immune system when combating invading pathogens [29]. Antioxidant defense systems have evolved as a means of protection against oxidative stress, with the transcription factor Nrf2 as the key regulator [30]. The antioxidant systems involved in the protection against free radicals are SOD, glutathione (GSH)-peroxidase, CAT, GSH, antioxidant vitamins A, E, and C. When the antioxidant systems are challenged by free radical generating events during the disease process, the activities of the antioxidant enzymes are affected and the antioxidant molecules are depleted [31]. Under expression of SOD, CAT, and Nrf2 are observed in the negative control group with upward regulation of these antioxidant genes in the treated groups in this study. Overexpression of SOD-B1 in T. brucei has shown hypersensitivity to a trypanocidal agent such as benznidazole and gentian violet [32].

Conclusion

The results of the invivo and insilico study suggests that A. laxiflora extract possess excellent antitrypanosomal property with the downregulation of proinflammatory genes TNF-α and IL-6, and up-regulation of antioxidant genes. This identifies A. laxiflora as a noble drug candidate for treatment of trypanosomiasis. Further molecular studies to identify specific phytochemical components responsible for the observed activities should be carried out.

Ethical approval

All of the animals used in this study received humane care according to the criteria outlined in the guide for the care and the use of laboratory animals prepared by the National Academy Science and published by the National Institute of Health (USA). The ethic regulations have been followed in accordance with national and institutional guidelines for the protection of animals’ welfare during experiments.

Competing interests

Authors have declared that no competing interests exist.

Authors’ contributions

Authors IBO and OOE did the conceptualization, methodology, supervision and editing, Authors DCO and ASO did the methodology, reviewing, formal analysis, writing, and editing. All authors read and approved the final manuscript.

REFERENCES

1. WHO. Trypanosomiasis, human African sleeping sickness. Fact sheet. WHO, Geneva, Switzerland, 2017. Available via www.who.int/meidacentre/factsheets/fsn259/en/accessed.

2. Ayodele OM, Akinyemi F, Charles D, Kim P, Michael VT, Susan CW. A longitudinal survey of African animal trypanosomiasis in domestic cattle on the Jos Plateau, Nigeria: prevalence, distribution and risk factors. Parasites Vectors 2013; 6:239; doi: 10.1186/1756-3305-6-239

3. Burri C. Chemotherapy against human African trypanosomiasis: is there a road of success? Parasitology 2010; 137:1987–94.

4. Rasool-Hassan BA. Medicinal plants (importance and uses). Pharm Anal Acta 2012; 3:139; doi: 10.4172/21532435.1000e139

5. Mergia E, Shibeshi W, Terefe G, Teklehaymanot T. Antitrypanosomal activity of Verbascum sinaiticum Benth. (Scrophulariaceae) against Trypanosoma congolense isolates. BMC Complement Altern Med 2016; 16:362; doi: 10.1186/s12906-016-1346

6. Ayawa NG, Ramon-Yusuf SB, Wada YA. Toxicity study and antitrypanosmal activities of aqueous and methanol whole plant extracts of Brillantaisia owariensis on Trypanosoma brucei-infection in BALB/c mice. Clin Phytosci 2021; 7:39; doi: 10.1186/s40816-021-00267-3

7. Durojaye CO, Osho IB. Therapeutic antitrypanosomal activity of Alchornea laxiflora leaf extract in rats experimentally infected with Trypanosoma brucei brucei. Eur J Pharm Med Res 2023; 10(2):193–8.

8. Schmelzer GH. Alchornea laxiﬂora (Benth.) Pax & K. Hoffm. [Internet]. Record from Protabase. In: Schmelzer GH, Gurib-Fakim A (eds.). PROTA (Plant Resources of Tropical Africa/Resources végétales de l’Afriquetropicale), Wageningen, Netherlands, 2007. Available via http://database.prota.org/search.htmN

9. Magwede K, van Wyk BE, van Wyk AE. An inventory of Vhavenḓa useful plants. S Afr J Bot 2019; 122:57–89; doi: 10.1016/j.sajb.2017.12.013

10. Oluyemi OF, Blessing OA. Prophylactic and curative potency of Alchornea laxiflora extract on Plasmodium berghei infected Swiss albino mice. Int J Trop Dis Health 2019; 36:1–11; doi:10.9734/ijtdh/2019/v36i130134

11. Nwodo UU, Ngene AA, Iruegbu CU, Obiiyeke GC. Effects of fractionation on antibacterial activity of crude extracts of Tamarindus indica. Afr J Biotechnol 2010; 9(42):7108–13.

12. Herbert WJ, Lumsden WH. Trypanosoma brucei: a rapid “matching” method for estimating the host’s parasitemia. Exp Parasit 1976; 40:427–31.

13. OECD. OECD (Organization for Economic Cooperation and Development) revised draft guidelines 423. OECD Guidelines for the testing of chemicals. OECD, 2001.

14. Maikai VA, Nok JA, Adaudi AO, Alawa CB. In vitro antitrypanosomal activity of aqueous and methanolic crude extracts of stem bark of Ximenia americana on Trypanosoma congolense. J Med Plants Res 2008; 2(3):55–8.

15. Maikai V. Antitrypanosomal activity of avonoid extracted from Ximenia americana stem bark. Int J Biol 2011; 1:115–21.

16. Angela O, Mustapha L, David MY. Anti-trypanosoma activity of the ethanolic leaf extract of Senna occidentalis (Fabaceae) on T. brucei brucei infected mice. Int J Basic Appl Sci 2013; 2:32–7.

17. Nweze N, Anene B, Asuzu I. Investigation of the anti-trypanosomal activity of Buchholzia coriacea seed extract against a field strain of Trypanosoma congolense. Afr J Tradit Complement Altern Med 2011; 8:175–80.

18. Ngulde S, Tijjani M, Ihopo J, Ya’uba M. Antitrypanosomal potency of methanolic extract of Cassia arereh Delile root bark in albino rats. Int J Drug Res Tech 2013; 3:1–7.

19. Oluyede DM, Lawal AO, Adebimpe MO, Olumegbon L, Elekofehinti OO. Biochemical and molecular effects of naringenin on the cardiovascular oxidative and proinflammatory effects of oral exposure to diesel exhaust particles in rats. Air Qual Atmos Health 2001; 14:1–19.

20. Moghadamtousi S, Goh B, Chan C, Shabab T, Kadir H. Biological activities and phytochemicals of Swietenia macrophylla King. Molecules 2013; 18(9):10465–83.

21. Akinpelu DA, Abioye EO, Aiyegoro OA, Akinpelu OF, Okoh AI. Evaluation of antibacterial and antifungal properties of Alchornea laxiflora (Benth.) Pax. & Hoffman. Evid Based Compl Alternat Med 2015; 2015:1–6.

22. Chukwudi C. Antibacterial and phytochemical screening of Alchornea laxiflora and Citrus aurantifolia collected from Ntalakwu in Bende L.G.A Abia State, Nigeria. Repository.mouau.edu.ng, 2020. Available via https://repository.mouau.edu.ng/work/view/antibacterial-and-phytochemical-screening-of-alchornea-laxiflora-and-citrus-aurantifolia-collected-from-ntalakwu-in-bende-l-g-a-abia-state-nigeria (Accessed 6 April 2023).

23. Jain NK, Tailang M, Kumar S, Chandrasekaran B, Alghazwani Y, Chandramoorthy HC, et al. Appraising the therapeutical potentials of Alchornea laxiflora (Benth.) Pax & K. Hoffm., an underexplored medicinal herb: a systematic review. Front Pharmacol 2022; 13:958453; doi: 10.3389/fphar.2022.958453

24. Aremu A, Eghianruwa IK, Biobaku KT, Ahmed OA, Raufu AI, Akorede GJ, et al. Methanolic leaf extract of Moringa oleifera improves the survivability rate, weight gain and histopathological changes of Wister rats infected with Trypanosoma brucei. Int J Vet Sci Med 2018; 6:39–44; doi: 10.1016/j.ijvsm.04:006

25. Wada YA, Oniye SJ, Rekwot PI, Okubanjo OO. Single and mixed interaction of experimental Trypanosoma brucei brucei and Trypanosoma evansi on the semen collection reaction time and spermatozoa morphology of Yankasa rams. JAVAR 2017; 3(4):360–7.

26. Shi M, Pan W, Tabel H. Experimental African trypanosomiasis: IFN-gamma mediates early mortality. Eur J Immunol 2003; 33(1):108–18; doi: 10.1002/immu.200390013

27. Magez S, Truyens C, Merimi M, Radwanska M, Stijlemans B, Brouckaert P. P75 tumor necrosis factor-receptor shedding occurs as a protective host response during African trypanosomiasis. J Infect Dis 2004; 189(3):527–39; doi: 10.1086/381151

28. Kuriakose SM, Singh R, Uzonna J. Trypanosoma congolense induced pro-inflammatory cytokine production is by the activation of TLR signaling system through MAPK and STAT proteins. Front Immunol 2016; 7:181; doi: 10.3389/fimmu.2016.00181

29. Herb M, Schramm M. Functions of ROS in macrophages and antimicrobial immunity. Antioxidants 2021; 10:313; doi: 10.3390/antiox10020313

30. Ngo V, Duennwald ML. Nrf2 and oxidative stress: a general overview of mechanisms and implications in human disease. Antioxidants 2022; 11:2345; doi: 10.3390/antiox11122345

31. Igbokwe IO. Evolving anti-disease strategies from biochemical pathogenesis of African trypanosomiasis. Adv Cytol Pathol 2018; 3(2):33–9; doi: 10.15406/acp.2018.03.00048

32. Prathalingham SR, Wilkinson SR, Horn D, Kelly JM. Deletion of the Trypanosoma brucei superoxide dismutase gene sodb1 increases sensitivity to Nifurtimox and Benznidazole. Antimicrob Agents Chemother 2007 Feb; 51(2):755–8.